If you don't remember your password, you can reset it by entering your email address and clicking the Reset Password button. You will then receive an email that contains a secure link for resetting your password
If the address matches a valid account an email will be sent to __email__ with instructions for resetting your password
Department of Interventional Radiology, Cancer Center, Guangdong Provincial People's Hospital, Guangdong Academy of Medical Sciences, Guangzhou, Guangdong, China
Primary hepatocellular carcinoma (HCC) is one of the most lethal tumor diseases in the world. Receptor tyrosine kinases (RTKs) are thought to play a vital role in HCC and Ephrin-A4 ligand (EFNA4) is a membrane-bound molecule that can activate RTKs through erythropoietin-producing hepatocellular (Eph) receptors. However, the specific role of EFNA4 remains unknown. The aim of our study was to explore the prognostic value of EFNA4 expression in HCC.
Methods
Bioinformatics analyses were conducted to probe the expression levels and prognostic value of EFNA4 in HCC. The quantitative real-time polymerase chain reaction, immunohistochemical and western blot were used to confirm the expression of EFNA4 in paired clinical specimens of HCC. Colony formation assay was used to confirm the proliferation of tumor cell.
Results
The expression of EFNA4 is generally elevated in various cancers. Especially, EFNA4 was upregulated in tumor tissue and associated with clinical stage in HCC patients. HCC patients with lower levels of EFNA4 possessed better survival and progression-free survival times. Colony formation assay indicated that the overexpression of EFNA4 promoted tumor cell proliferation.
Conclusion
These results demonstrated that EFNA4 played as an oncogenic gene and a prognostic biomarker for HCC patients.
However, their antitumor efficacy is unsatisfactory. Great efforts have been made to find new biomarkers to predict the prognosis of HCC and even as a therapeutic target.
which play a critical role in tumor growth. Ephrins, as ligands for Eph receptors, are membrane-bound molecules and divided into two subfamilies based on their mode of membrane attachment.
Recent study showed that Ephrin-A4 ligand (EFNA4) was elevated in non-small-cell lung cancer, ovarian cancer, triple-negative breast cancer (TNBC), and colorectal cancer.
Anti-EFNA4 calicheamicin conjugates effectively target triple-negative breast and ovarian tumor-initiating cells to result in sustained tumor regressions.
However, the role of EFNA4 in HCC hasn't been elucidated clearly.
In this research, we unveiled the relation between EFNA4 expression and the clinical predictive value for HCC patients. Our result suggested that EFNA4 expression might serve as a promising biomarker for HCC and even as a novel target for HCC treatment.
Materials and Methods
Patients and Samples
Thirty-six patient diagnosis with HCC were recruited from Panyu Central Hospital (Table 1). Tumor and adjacent nontumor liver tissues were obtained immediately and preserved in liquid nitrogen until investigation. The utilization of HCC specimens was approved by the Ethics Committee of Panyu Central Hospital, and informed consents were signed by all patients.
Table 1Overview of Clinical Information of 36 HCC Patients.
Variable
Number/Mean ± SD
Gender (male/female)
32/4
Age (year)
52.61 ± 12.59
HBV DNA (≥/<100 copies/ml)
15/21
Alpha fetoprotein (>20/≤20 μg/L)
18/18
Alanine aminotransferase (>40/≤40 U/L)
15/21
Total bilirubin (>17/≤17 μmol/L) Cirrhosis (yes/no)
RNA Extraction and Quantitative Real-time Polymerase Chain Reaction (qRT-PCR)
Total RNA was extracted from tumor and adjacent nontumor liver tissues using TRIzol reagent (Invitrogen). The RNA was then transcribed using Transcriptor First Strand cDNA Synthesis Kit (Roche). Quantitative mRNA expression of EFNA4 was performed with TB Green™ Premix Ex Taq™ detection kit (TaKaRa) at 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s and 60 °C for 30 s. The following was the primer sequences: EFNA4 (forward primer GGGCCTCAACGATTACCTAGACA: reverse primer: GCCAGTCCACCATGTACAAAGCA); β-actin (forward primer: AGCGAGCATCCCCCAAAGTT, reverse primer: GGGCACGAAGGCTCATCATT). These primers were synthesized by RuiBiotech (China). The relative expression of EFNA4 mRNA level was calculated with the 2−ΔΔCт method.
Immunohistochemistry
Tissue specimens were formalin-fixed and paraffin-embedded. After deparaffinization, hydration, and blocking, the specimen slides were incubated with anti-EFNA4 goat polyclonal antibody (Cat. No. #AF369, R&D, USA) overnight at 4 °C and rabbit anti-goat HRP for 1 h at room temperature (RT). Slides were evaluated by comparison of staining between tumor tissue and para-tumor tissues by two technicians.
Western Blot
After protein separation by 10% SDS-PAGE, the targeted proteins were transferred into 0.22 μm nitrocellulose membranes. After blocking, incubating with anti-EFNA4 goat polyclonal antibody (Cat. No. #AF369, R&D, USA) or anti-Flag antibody (Cat. No. #86861, CST, USA) for 16–18 h at 4 °C and the appropriate horseradish peroxidase (HRP)-conjugated antibody for 1 h at room temperature, the targeted proteins were tested by the ECL (Merck Millipore) method. β-actin monoclonal antibody, acted as control, was obtained from CST company (Cat. No. #4970, CST, USA). The semiquantitative results were determined using Image J.
Cell Culture, Transfection, and Clone Formation Assay
HCC cell lines MHCC97H and SMMC-7721 were acquired from the Guangzhou Jennio Biotech Co., Ltd (GD, China). The cells were transfected with the Sh-EFNA4-Flag (Cat. No. # LPP-O0042-Lv241, GeneCopoeia, USA) or Sh-NC-vector (Cat. No. # LPP-NEG-Lv241, GeneCopoeia, USA) plasmids. The colony formation assay was performed. Briefly, cells (1 × 102 per well of a 6-well plate) were cultured for up to 2 weeks at 37 °C in 5% condition. Cells were fixed and stained with 6% glutaraldehyde and 0.5% crystal violet (Cat. No. #C8470, Solarbio, China) for 60 min at RT. Results were determined by the relative colony formation capacity.
Statistical Analysis
Data were analyzed with SPSS version 20.0 software. The Mann–Whitney test and Wilcoxon's signed-rank test were used to analyze the significant differences between two groups. Kruskal–Wallis analysis was used for comparisons of more than two groups. The chi-square test was applied for comparison of categorical variables. The survival curves of HCC patients were analyzed from Kaplan–Meier plotter and then analyzed via log-rank test. A value of P < 0.05 was considered statistically significant.
Results
The mRNA Expression of EFNA4 is Overexpressed in Various Cancers
To explore the expression of EFNA4 in different types of cancers, the TCGA database was employed. Among 31 types of cancers detected, mRNA expression of EFNA4 was significantly overexpressed in bladder urothelial carcinoma (BLCA), breast invasive carcinoma (BRCA), cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC), cholangiocarcinoma (CHOL), colon adenocarcinoma (COAD), lymphoid neoplasm diffuse large B-cell lymphoma (DLBC), glioblastoma (GBM), liver hepatocellular carcinoma (LIHC), lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC), pancreatic adenocarcinoma (PAAD), pheochromocytoma and paraganglioma (PCPG), prostate adenocarcinoma (PRAD), rectum adenocarcinoma (READ), skin cutaneous melanoma (SKCM), stomach adenocarcinoma (STAD), testicular germ cell tumors (TGCT), thymoma (THYM), uterine corpus endometrial carcinoma (UCEC), and uterine carcinosarcoma (UCS) (Figure 1).
Figure 1EFNA4 is upregulated in various tumors. EFNA4 mRNA expression analysis from the GEPIA2 web portal. ∗P < 0.05.
We found that mRNA expression of EFNA4 was significantly high in HCC from TCGA database across all known Ephrins subtypes. To confirm the results from TCGA database, tumor and adjacent peri-tumor tissues from HCC patients were collected (Table 2). The mRNA expression level of EFNA4 was obviously increased in tumor tissues using qRT-PCR (Figure 2A). Protein expression of EFNA4 was also higher in tumor tissues than paired peri-tumor tissues using immunohistochemical (IHC) (Figure 2B) and confirmed by western blot (WB) (Figure 2C–D). In a word, EFNA4 was upregulated in HCC tumor tissues.
Table 2The Differential Expression of EFNA4 in Different Databases.
Dataset
Comparison
Fold change (copy number units)
P value
GSE36376
HCC vs. liver
1.08
<0.0001
GSE25097
HCC vs. liver
2.21
<0.0001
GSE6764
HCC vs. liver
2.45
0.0042
GSE63898
HCC vs. liver
1.22
<0.0001
GSE22058
HCC vs. liver
1.14
<0.0001
GSE64041
HCC vs. liver
1.08
<0.0001
TCGA (LIHC)
HCC vs. liver
1.23
<0.0001
GSE54236
HCC vs. peri-HCC
1.08
<0.0001
GSE64041
HCC vs. peri-HCC
1.08
<0.0001
TCGA (LIHC)
HCC vs. peri-HCC
1.22
<0.0001
HCC, hepatocellular carcinoma; LIHC, liver hepatocellular carcinoma; TCGA, The Cancer Genome Atlas database
Figure 2EFNA4 is overexpressed in HCC tumor tissues compared with peri-tumor tissues. (A) The relative expression of qRT-PCR results between HCC tumor tissues (n = 36) and peri-HCC tissues (n = 36). (B) IHC staining and (C) WB represented EFNA4 protein expression level in HCC and peri-HCC tissues. (D) The semiquantitative results of WB derived EFNA4/β-Actin were applied.
Upregulation of EFNA4 Predicts a Poor Prognosis in HCC Patients
Next, we try to probe the prognostic value of EFNA4 expression in HCC patients using TCGA and GEO database (GSE6764). The expression of EFNA4 was correlated with the TNM stage of HCC and precancerous liver disease (Figure 3A and B). EFNA4 expression was also negatively correlated with tumor double time (Figure 3C). Kaplan–Meier (KM) curves indicated that HCC patients with high level of EFNA4 have poorer overall survival (HR = 2 [1.29–3.1], P = 0.0015), progression-free survival (HR = 1.52 [1.04–2.22], P = 0.028), relapse-free survival (HR = 1.08 [1.19–2.85], P = 0.005), and disease-specific survival (HR = 2.1 [1.17–3.77], P = 0.011) rates than those with low level of EFNA4 (Figure 3D–G). The data indicated that upregulation of EFNA4 was an unfavorable prognostic factor for HCC patients.
Figure 3The prognostic effect of EFNA4 expression in HCC patients. EFNA4 expression in different clinical stage were analyzed from (A) GEPIA2 and (B) GSE6764. (C) Correlation between EFNA4 expression and tumor double time. (D) Overall survival (OS), (E) progression-free survival (PFS), (F) relapse-free survival (RFS) and (G) disease specific survival (DSS) curve based on high and low expression levels of EFNA4 from the Kaplan–Meier plotter survival analysis platform.
Overexpression of EFNA4 Promotes the Colony Formation of HCC
To explore the potential biological function of EFNA4 in HCC tumorigenesis, HCC cell lines were transfected with plasmids containing EFNA4 shRNA (OE) or control vector (VEC). Both protein and mRNA expression of EFNA4 were significantly elevated after transfection (Figure 4A and B). Overexpression of EFNA4 promoted proliferation abilities in SMMC-7721 and MHCC97H cells as determined by colony formation assay (Figure 4C and D). These results showed that EFNA4 could promote tumor cell proliferation in vitro.
Figure 4Overexpression of EFNA4 promote cell proliferation in vitro. WB (A) and qRT-PCT (B) analysis of EFNA4 overexpression in SMMC-7721 and MHCC97H cell lines. (C) Representative images of the role of EFNA4 overexpression on the proliferation abilities of cells as determined by the colony formation assay. (D) Proliferation abilities were quantification by Graphpad Prism 6.0 software (United States). All of the experiments were performed at least three times. Data was shown as the mean ± SD. ∗P < 0.05.
Primary hepatocellular carcinoma is one of the most invasive tumors that kill millions of people worldwide. Apart from liver resection, oral multikinase inhibitors, such as sorafenib and lenvatinib, were one of the few choices available for HCC patients, but the efficacy varied from patients.
Therefore, prognostic biomarkers and targets for HCC therapy are urgently needed. In this research, we found that EFNA4 was upregulated in HCC and promoted tumor growth, which might greatly contribute to the development of cancer therapeutic target in HCC.
The family of receptor tyrosine kinases (RTKs) contain Eph receptors that consisted of two split subfamilies, the type A Eph receptors and the type B Eph receptors. Moreover, the ligands for Eph receptors, called ephrins, which are membrane-anchored, can induce bidirectional signaling to affect receptor-expressing cell and the ligand-expressing cell.
Generally, Eph forward signaling suppresses malignancy except for some cases that cancer cells that have evaded the negative effects of Eph forward signaling.
Anti-EFNA4 calicheamicin conjugates effectively target triple-negative breast and ovarian tumor-initiating cells to result in sustained tumor regressions.
Furthermore, previous clinical experience that targets the EphA2 (MEDI-547) resulted in serious adverse events in humans (50%), including conjunctival hemorrhage, pain, liver disorder, and hemorrhage.
In addition, EphA5 seemed to be a promising target for HCC therapy. Combined kinase inhibition (anaplastic lymphoma kinase, fibroblast growth factor receptor 2, and EphA5) produced excellent therapeutic effect both in vitro and in vivo.
However, clinical medication safety and efficacy of targeting EphA5 required further investigation.
EFNA4 is one of the most widely overexpressed Eph receptors ligands in various tumors. Except for EFNA4, TCGA database revealed that none of the ephrins demonstrated notable genomic alterations in LIHC. Recently, PF-06647263, an anti-EFNA4 calicheamicin antibody–drug conjugate (anti-EFNA4-ADC), had shown potent antitumor activity in triple-negative breast cancer and ovarian cancer patient-derived xenografts (PDX) model. A phase I clinic trial (NCT02078752) showed that the adminstration of anti-EFNA4-ADC was safe and appeared to have antitumor effect in advanced solid tumors.
However, HCC patients were not recruited in both studies. Our study showed that EFNA4 was obviously elevated in tumor tissues. Higher level of EFNA4 was associated with advanced stage of HCC and a worse prognosis in HCC patients. Overexpression of EFNA4 promoted HCC cell proliferation in vitro, suggesting that EFNA4 as a new powerful target for HCC treatment. Further evidence on antitumor activity of EFNA4 in patients with HCC is required.
In conclusion, our study affirm that EFNA4 may be applied as a biomaker, with lower expression forecasting better outcome in HCC patients. The underlying molecular mechanisms on EFNA4 promoting tumorigenicity required further investigation.
Credit authorship contribution statement
Xihua Fu, Haibo Lou, Xiaolin Zhu, and Zide Chen designed the study. Ling Guo, Yanjun Mai, and Xiaolin Zhu collected research data. Haibo Lou, Zide Chen, and Peng Ye performed the experiment. Peng Ye performed data analysis. Xiaolin Zhu wrote the manuscript. Xihua Fu, Haibo Lou, Zide Chen, and Peng Ye revised the manuscript. All authors read and approved the final manuscript.
Conflicts of interest
All authors have none to declare.
Acknowledgments
Due to the limited space: we apologize for any publications that may be omitted from the references. We thank professor Wen-Hao Yang and Chengchong Chen for help with sample collection and storage.
Funding
This work was supported by the Science and Technology Program of Guangzhou (Grant No. 201904010065).
Data sharing statement
The datasets used in support of the findings of this study are available from the corresponding author at [email protected] upon request.
References
Bray F.
Ferlay J.
Soerjomataram I.
Siegel R.L.
Torre L.A.
Jemal A.
Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries.
Anti-EFNA4 calicheamicin conjugates effectively target triple-negative breast and ovarian tumor-initiating cells to result in sustained tumor regressions.
00062-2&id=gr1.jpg){kind=link}
00062-2&id=gr2.jpg){kind=link}
00062-2&id=gr3.jpg){kind=link}
00062-2&id=gr4.jpg){kind=link}